Молекулярно-генетический анализ образца ткани «баганалинского червя»

Введение

В последние годы вследствие существенного расширения использования молекулярно-генетических методов анализа исследователям открылись новые, недоступные ранее точные методы идентификации живых организмов. Благодаря этому, например, в териофауне Беларуси недавно был выявлен такой новый вид, как золотистый шакал [1]. Установление видовой принадлежности может проводиться на основании анализа всей доступной информации – описание внешнего вида и особенностей поведения наблюдаемого животного со стороны очевидцев, исследование ДНК доступного биологического материала с мест наблюдения и др. На основании данного анализа можно определить принадлежность животного к конкретному виду, либо таксону более высокого ранга (семейства, отряды, классы и т. д.). Однако зачастую наблюдатели могут неверно интерпретировать те или иные следы, оставленные животным, что приводит к распространению слухов о мифических существах, сочетающих в себе черты различных видов [2].

В январе 2016 года в ауле Баганалы Аулиекольского района Костанайской области Казахстана кочегар Геннадий Кузнецов обнаружил в куче угля1 некий кожистый коричневый «кокон» овальной формы. Он разбил его лопатой и увидел внутри живую «личинку» белого2 цвета, размером около 20 см у которой можно было различить некую «лапу» и «зубы». Коконообразное яйцо, в котором находилась эта особь, по словам очевидца, плавало в полости, наполненной жидкостью наподобие глицерина. По словам информанта, когда лопата задела «кокон», то прилипла к нему и по находке прошла как бы синевато-красноватая «рябь». Несмотря на почти тридцатиградусный мороз, в течение примерно полутора часов, возможно, благодаря содержимому «кокона», существо еще подавало «признаки жизни» [3, 4, 5]. Первым из биологов находку (рис. 1) осмотрел научный сотрудник отдела природы областного историко-краеведческого музея управления культуры акимата Костанайской области А. В. Андрющенко, который отметил, что на образце были видны следы кровеносной системы, но то, что это отдельное животное, без детального препарирования утверждать было нельзя [5]. А. В. Андрющенко полагал, что речь может идти об останках какого-то теплокровного животного, утверждая, что «именно останки, часть организма, но не отдельное существо»; специалист считал, что без анализа ДНК снять эти вопросы невозможно [6].

Рис. 1. Внешний вид находки из аула Баганалы во время ее осмотра специалистами
Рис. 1. Внешний вид находки из аула Баганалы во время ее осмотра специалистами
 

В первое время выдвигалось множество версий о принадлежности существа к определенному классу живых существ, его называли рептилией [7], червем [8], брюхоногим моллюском [4, 8] и т. д. Например, аульный ветеринар Серик Ибраев, так описал находку, которую осмотрел дома у Г. Кузнецова: «Оно покрыто мелкими волосами и имеет два ряда зубов. Ничего подобного за всю свою жизнь я не видел. Размером в 20 сантиметров. Это не может быть слизняком или червем-паразитом, известным науке, – они ведь не размножаются яйцами. Тем более яйцо было размером с футбольный мяч. Это рептилия. Причем очень страшная!» [7]. Но так как ни одна из предложенных версий не могла внятно объяснить всех особенностей поведения и внешнего вида существа, его чаще всего называли «неизвестным науке видом» и даже «инопланетным существом», возможно, попавшим на Землю с метеоритом.

В дальнейшем образцы (остатки «кокона» и самого существа) поместили в стерильный бикс и отправили на кафедру естественных наук Костанайского государственного педагогического института (КГПИ), где биоматериалы некоторое время хранились в холодильной камере. После морфологического исследования кандидат биологических наук, заведующий кафедрой естественных наук КГПИ Дамеля Конысбаева с сотрудниками высказала предположение о том, что кокон больше походит на требуху (фрагмент кишечного тракта и части трубчатых органов) какого-либо жвачного животного; в нем были обнаружены непереработанные зерна пшеницы и овса, трава, фрагменты грубых кормов, химуса желудочно-кишечного тракта, в то же время полая ткань, без кровеносной системы, являлась, возможно, частью кишки [9, 10].

Так как исследования в КГПИ не смогли однозначно и быстро ответить на вопрос о таксономической принадлежности животного, возникший «вакуум» информации заполнили некоторые средства массовой информации [3], которые связали останки червя с распространенными во всей Центральной Азии [11, 12], в основном, в Монголии [13, 14, 15, 16], легендами об олгой-хорхое – неком таинственном черве, которого местное население считает крайне ядовитым [17]. Таким образом, останки «баганалинского червя» некоторое время неофициально назвали «личинкой олгой-хорхоя».

Впервые об олгой-хорхое на территории Монголии сообщил в 1926 году американский палеонтолог Р. Ч. Эндрюс, который записал его название в транскрипции «allergorhai-horhai» и, хотя исследователь и сомневался в его существовании, но уверенно причислял олгой-хорхоя к рептилиям [13, 14]. В русскоязычной литературе обычно употребляется написание олгой-хорхой или, реже, аллегорхай-хорхай. В переводе с монгольского олгой-хорхой означает «кишка-червяк»3, либо очень большой червяк [11]. В казахстанской части пустыни Кызылкумы в 1940-х годах можно было услышать сходные легенды, где этого существо называли шужык (досл. «колбаса») [18]. Бурятские сойоты4 убеждены, что этот жуткий червяк вообще существо пещерное, не любит яркого света и выползает наружу только в сумерках [12]. По некоторым данным, наблюдатели не замечали у него ни рта, ни глаз («то ли два хвоста, то ли две головы с обеих сторон»), длина же, по разным оценкам, от 50 см до 1 м [12, 14, 15, 19]. Животное похоже на белесую (иногда говорится о светлых полосах по бокам) «кишку», одинаково ровно закругленную с обоих концов, причем в момент атаки он темнеет (либо меняет цвет) и сворачивается в спираль. Кроме пустынь, местом его обитания называют еще каменные осыпи и горные ущелья. Поход в такие места после заката солнца у местного населения Бурятии табуирован [12].

В 1940-е годы в экспедициях в Гоби принимал участие доктор биологических наук, известный палеонтолог И. А. Ефремов. Ему также доводилось слышать об этом «черве»5, которого якобы можно было встретить только в самое жаркое время (июнь-июль), в остальное время эти червяки якобы спят в норах в песке [16, 20, 21]. В то время, по словам Ефремова, легенды о нем были широко распространены в Монголии, один из вожаков караванов, по фамилии Цевен, утверждал, что олгой-хорхой обитает в «недоступном урочище Халдзан Дзахе6 в Южной Гоби» [21]. Как пишут С. Л. Кузьмин, Х. Мунхбаяр, Ж. Оюунчимэг в монографии «Земноводные Монголии», в некоторых районах Гоби почти все жители утверждали, что в глухих местах есть черви, убивающие на расстоянии7 [23]. Известный исследователь Монгольской народной республики А. Д. Симуков также отмечает: «Олгой хорхой в Цзаг сучжин гоби довольно обыкновенен. Говорят о нем много и очень боятся. Если он появляется в юрте – скочевывают. На поверхности он появляется чаще всего после дождей, когда земля сыровата. В юртах олгой хорхой появляется по большей части под ведрами, где бывает сыро. Упорно говорят о его ядовитости. Цвет определяют как «белая парча». Кроме «олгой хорхоя» жители Цзаг сучжин гоби говорили о «темен суль хорхой», определяя его как бесхвостую ящерицу» [24]. Учитывая, что «тэмээнсYYл» – это монгольское название для восточного удавчика (Eryx tataricus), С. Л. Кузьмин с соавторами считают, что олгой-хорхой – «или какое-то другое животное, или молодой удавчик» [23]. Аналогичной версии придерживался и Ю. К. Горелов, старший научный сотрудник Бадхызского заповедника (Туркменистан), который показывал экземпляр восточного удавчика одному из очевидцев в Монголии и тот уверенно называл его олгой-хорхоем [19]. А. Д. Симуков даже поместил олгой-хорхоя в таблицу с распространенными у монголов названиями местных животных, полагая его одним из наименований удавчика – Тэмээн сүүлт могой [25].

Геолог Ю. О. Липовский, который в 1960–1970-х годах работал в МНР, в одной из своих книг описывает, как в Ноен-сомоне их партии удалось от старых аратов услышать легенду о том, что в Южной Гоби якобы обитает олгой-хорхой – «последний из рода динозавров». Старики рассказывали, что «чудовище якобы прячется в саксауловых рощах, появляется внезапно, и горе человеку, оказавшемуся вблизи: он не выдерживает взгляда дракона и погибает». Дракон, по слухам, даже «прибрал старателей», которые пожаловали на его территорию в поисках драгоценных камней. Возможным прототипом олгой-хорхоя Ю. О. Липовский считает причудливые образы в местных камнях, в частности, агальматолите, и особенно – на восходе или закате солнца. Например, на одном из образцов агальматолита во время экспедиции неожиданно вскрылся рисунок, чем-то похожий на сидящего дракона, и монголы действительно приняли его за олгой-хорхоя [26].

Популяризатор науки В. А. Мезенцев полагает, что предположение о мощном электрическом разряде, которым якобы червь поражает своих жертв, несостоятельно, так как песок пустыни – хороший изолятор. Чтобы убить или даже оглушить человека, требуется очень большое напряжение электрического тока – не менее 1000 вольт. Ученый склоняется к версии о том, что вероятнее всего таинственный обитатель пустыни убивает ядом, например, синильной кислотой, которая в условиях сухого и жаркого климата пустынь, попадая в воздух, может быстро превращаться в смертельные испарения. Он пишет: «Можно представить себе такую картину: огромный червяк в момент опасности быстрым движением свертывается в кольцо и выбрасывает в воздух капли синильной кислоты. Испарение делает свое дело – жертва падает замертво». В. А. Мезенцев предполагает, что это может быть один из представителей семейства червеобразных двупарноногих многоножек – кивсяков (Julida). Кроме того, как указывает автор, в семействе кивсяков есть виды, которые выбрасывают как раз синильную кислоту [11]. Аналогичного мнения придерживался и писатель Г. Е. Трифонов (публиковался под псевдонимом М. Демин) в одной из книг своей автобиографической трилогии. Он пишет: «Многоножка очевидно поздний, выродившийся вид. А где-то в азиатских ущельях сохранилось первоначальное чудовище. Чрезвычайно редкое, но, безусловно, реальное» [12]. Выдвигались и другие предположения о прототипе легендарного червя – неизвестный вид сцинка (Scincidae); близкий родственник двуходки или амфисбены (Amphisbaenia), в ходе эволюции утративший конечности; крупный кольчатый червь (Annelida), который приспособился к обитанию в условиях пустыни и др. Таким образом, проведя молекулярно-генетический анализ находки из аула Баганалы Костанайского района, мы могли бы, возможно, поставить «точку» в вопросе видовой принадлежности центральноазиатского «олгой-хорхоя».

Цель исследования: установить таксономическую принадлежность находки из Костанайского района Казахстана методом ПЦР-анализа.

Материалы и методы. Забор образца (около 5 см длины) был выполнен в первые же сутки после обнаружения находки В. А. Чернобровом путем помещения его в стеклянную стерильную емкость с 80%-м раствором этилового спирта. В дальнейшем он хранился в течение трех лет при комнатной температуре. В 2019 году два фрагмента образца по 1 см каждый (рис. 2) были любезно предоставлены авторам М. В. Семеновой для последующего молекулярно-генетического анализа.

Рис. 2. Внешний вид образцов, участвующих в анализе
Рис. 2. Внешний вид образцов, участвующих в анализе
 

Генетический анализ образцов ткани был проведен в ГНУ «Институт генетики и цитологии НАН Беларуси» в рамках проекта международной технической помощи «Усиление людских ресурсов, правовых систем и институционального потенциала для реализации Нагойского протокола в Республике Беларусь» № 2/18/000874 от 30.03.2018.

Выделение ДНК из образца проводили методом экстракции смесью фенола и хлороформа [27]. Участок гена цитохрома b (более 400 п.н.) амплифицировали с использованием универсальных праймеров mcb398 (TACCATGAGGACAAATATCATTCTG) и mcb869 (CCTCCTAGTTTGTTAGGGATTGATCG) [28].

Полимеразную цепную реакцию (ПЦР) осуществляли в объеме 15 мкл содержащем следующие компоненты: 1,5 ед. полимеразы (ArtStart, «Артбиотех»), 1x ПЦР-буфер, 1,5 ммоль/л MgCl2, 200 мкмоль/л каждого dNTP, 250 ммоль/л прямого и обратного праймера, 0,5 мкл тотальной геномной ДНК. При постановке реакции использовали следующий режим: реакцию начинали плавлением ДНК при 95 °С в течение 2 мин., затем проводили 35 циклов: 95 °С – 10 c, 51 °С – 30 c, 72 °С – 1 мин. Завершали реакцию финальной элонгацией при 72°С в течение 5 мин, после чего смесь охлаждали до 16 °С.

ПЦР проводили в трех повторностях. В результате реакции образовывался фрагмент ожидаемой длины (рис. 3).

Рис. 3. Электрофореграмма продукта ПЦР с праймерами mcb398 и mcb869. 1 – маркер GeneRuler 100 bp Plus DNA Ladder, 2, 3, 4 – продукт ПЦР, 5 – контроль без матрицы
Рис. 3. Электрофореграмма продукта ПЦР с праймерами mcb398 и mcb869. 1 – маркер GeneRuler 100 bp Plus DNA Ladder, 2, 3, 4 – продукт ПЦР, 5 – контроль без матрицы
 

ПЦР-продукты очищали с помощью набора NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Германия) и секвенировали в двух повторностях с использованием BrilliantDye™ Terminator Cycle Sequencing Kit v3.1 (Nimagen) и генетического анализатора ABI Prism 3500 Genetic Analyzer (Thermo, США).

Полученные хроматограммы (рис. 4) были преобразованы в нуклеотидные последовательности с помощью программы Chromas 1.45.

Рис. 4. Интерфейс Chromas 1.45, отображающий часть полученной хроматограммы
Рис. 4. Интерфейс Chromas 1.45, отображающий часть полученной хроматограммы
 

Нуклеотидные последовательности участка целевого гена были обработаны при помощи онлайн-ресурса Nucleotide BLAST, позволяющего достоверно определить видовую принадлежность полученных последовательностей (https://blast.ncbi.nlm.nih.gov).

Результаты и обсуждение

В результате анализа образцов была выявлена результирующая последовательность:

TGTTAGGGATTGATCGTAAGATTGCGTATGCAAATAAGAAGTATCACTCGGGTTTGATGTGAGGGGGTGTGTTGAGTGGATTGGCTGGGGTGTAGTTATCTGGGTCTCCGAGGAGGTCGGGTGCGAATAGTACTAGTAGTATTAGAGCTAGAATTAGTAAGAGGGCCCCTAAGATATCCTTAATGGTATAGTAGGGGTGGAATGGGATTTTGTCTACGTCTGAGGAAATTCCTGTTGGGTTGTTGGAGCCTGTTTCGTGGAGGAATAGTAGGTGGACTATGGCAATTGCTATGATGATAAATGGAAGGATAAAATGGAAAGCGAAGAATCGGGTAAGGGTTGCTTTGTCTACTGAGAATCCGCCTCAGATTCATTCGACTAAATTTGTGCCGATGTATGGGATTGCTGATAAGAGGTTGGTGATGACTGTTGCTCCTCAGAATGATATTTG

Анализ с помощью Nucleotide BLAST показал, что полученная последовательность ДНК соответствует виду дикий бык (Bos Taurus) (рис. 5). В работе, из которой взяты гомологичные последовательности речь идет о Yunling Cattle, которые представляют собой помесь В. taurus и В. indicus [29]. Поэтому для установления внутривидовой принадлежности был проведен дополнительный анализ.

Рис. 5. Результат анализа полученной последовательности в Nucleotide BLAST
Рис. 5. Результат анализа полученной последовательности в Nucleotide BLAST
 

Результаты исследования соответствуют данным, полученным в лаборатории патоморфологии и гистологии Костанайского государственного университета имени им. А. Байтурсынова (КГУ) и в инновационном научно-образовательном центре (ИНОЦ) при КГУ, где материал также был подвержен комплексным генетическим, гистологическим, гистохимическим и морфометрическим исследованиям на предмет установления его происхождения. Результаты ДНК-анализа не публиковались, но были представлены в официальном письме из ИНОЦ в природоохранную прокуратуру Костанайской области и для верификации отправлены в лабораторию ЗАО «Синтол» (Москва, РФ). В частности, в письме отмечалось, что из анализируемого материала выделено 6 образцов ДНК и проведена амплификация ДНК методом полимеразной цепной реакции (ПЦР). Фрагментный анализ по локусам ДНК позволил установить, что данный биологический материал получен от крупного рогатого скота (также без уточнения вида и подвида) [30].

Хотя анализируемый в лаборатории патоморфологии и гистологии КГУ образец подвергся частичной мацерации, комплексный анализ позволил доктору ветеринарных наук, профессору КГУ, А. А. Тегзе, по весовым и линейным промерам (масса, длина, ширина трубчатой части материала), по степени зрелости тканей исследуемого объекта (ткани сосудов, жировая ткань), а также по гистологическим характеристикам (эпителий: однослойный цилиндрический эпителий, положение ядер клеток, большое количество митозов, закладка желез и др.) сделать вывод о том, что «червь» – часть рога матки нерожавшей телки возрастом 11–13 месяцев (менее вероятно, что это часть пищевода). В свою очередь, фрагменты «кокона» определены как внутренняя жировая ткань – сальник [31].

Таким образом, удалось достоверно установить, что биологические образцы из аула Баганалы, представленные нам на анализ, принадлежат виду дикий бык (Bos Taurus), а, с учетом дополнительных исследований, проведенных ИНОЦ, более вероятно – корове (Bos Taurus taurus). Скорее всего – это фрагмент трубчатых органов животного, с высокой долей вероятности, рога матки или пищевода. Если исключить версию с преднамеренным обманом или дезинформацией, то можно выдвинуть несколько предположений о том, почему ошибся очевидец. Можно предположить, что останки животного были привезены с углем и находились под его слоем, т. е. в прослойке с относительно стабильной положительной температурой. Когда «кокон» из внутренних органов разрушился от удара лопатой, возможно, выпавшие наружу органы стали сокращаться на сильном морозе, создавая иллюзию движения. Сходной версии придерживается и А. А. Тегза8, которая считает, что «неопознанный организм», после раскрытия «кокона», создавал иллюзию движения по причине приобретения естественной, слегка изогнутой, дугообразной формы рога матки. Один из фрагментов, поступивших на анализ в КГУ, имел длинные «сосочки», вероятно, в месте отрыва краев лоскутка сальника – при большом воображении их можно было принять за два ряда зубов и лапу.

Стоит упомянуть, что во многом благодаря таким резонансным событиям легенда об олгой-хорхое (т. е. червеобразном существе, ведущем подземный образ жизни, и чрезвычайно ядовитом) и сходных с ним мифологических пресмыкающихся не только культивируется среди местного населения, но проникла далеко за пределы Монголии и Казахстана. Встречаются такие рассказы и на белорусско-литовском пограничье. Так, в Швенчёнском, Рокишкском и Зарасайском районе Литвы, а также Шарковщинском р-не Беларуси фиксируются рассказы о неких «земляных» или «подземных» гадах, выползающих на поверхность один раз в семь лет, причем укус их смертелен. Описывают информанты и внешний вид земляного гада – длиной 50–60 см, толщиной 5–7 см, «черный-чёрный; в его нет головы», круглый, как каталка [32, 33]. Единичные фиксации, вероятно, о том же самом «земляном гаде» сделаны нами и на территории Беларуси, например, в Ивьевском р-не Гродненской обл. (здесь его нам назвали «змееудавом»9). В то же время по всей территории Беларуси распространено представление о слимене (или сливене, реже сляпни) – которого считают змеей, чей укус смертелен. При этом чаще всего речь идет о безногой неядовитой ящерице – веретенице ломкой (Anguis fragilis) [34]. Подобное наделение неядовитой ящерицы столь нехарактерными ей чертами достоверно до сих пор не объяснено, но очевидно по сходным принципам формировался и образ чрезвычайно ядовитого олгой-хорхоя. Чаще всего субстратом легенд являются недостаточная информированность населения о реальных видах, населяющих ту или иную территорию, и особенностях их поведения, что и произошло, по всей вероятности, в истории с «банагалинским червем». В этой связи можно сделать предположение, что олгой-хорхой и схожие с ним мифологические пресмыкающиеся – не некое известное или даже неизвестное существо, а лишь собирательный образ, за которым кроются для каждой конкретной местности различные виды, порождающие иногда страх и суеверный ужас у местного населения. Причины этого первобытного страха, приводящего к возникновению ряда фобий, заложены эволюцией на генетическом уровне и почти не зависят от региона.

Выводы

Образцы, представленные на анализ, могут быть идентифицированы как фрагмент трубчатых органов коровы (Bos Taurus taurus), с высокой долей вероятности, рога матки или пищевода.

Наглядно показано, как рождаются современные слухи об олгой-хорхое и как им может противостоять современная наука.

Олгой-хорхой и сходные с ним мифологических пресмыкающихся – не некое известное или даже неизвестное существо, а лишь собирательный образ, за которым кроются для каждой конкретной местности различные виды животных, чаще всего неядовитых особей.

Примечания

1. По разным данным уголь был добыт или на Майкубенском буроугольном бассейне (Баянаульский район Павлодарской области) или в Экибастузском угольном бассейне (район г. Экибастуза Павлодарской области).

2. Коричневатый или сероватый цвет позже она могла приобрести из-за остатков угольной крошки.

3. Олгой – «толстая кишка», хорхой – «червь». Есть и другие варианты перевода, например, «кишечный червь» [15].

4. Коренной народ, населяющий Окинский район Республики Бурятия.

5. Первоначально И. А. Ефремов, знакомый с трудами Р. Ч. Эндрюса, называл червя «аллегорхай-хорхай», но позже изменил на более точное – олгой-хорхой [22].

6. Досл. Лысый край. Расположено примерно в 130 км восточнее от г. Даландзагад аймака Умнеговь (Южно-Гобийского) Монголии.

7. С. Цэрэндаши, В. Дугэрмаа, личные сообщения.

8. Неопубликованное сообщение.

9. «Чорная i такое, як змяя, ну, можа, толшча маей рукi <…> Ляжыць як палка такая блесцяшчая, якая-та галава, ну, пахожа, можа, на змяю. I такое блестящее, што, ну вот, лакам пакрыта!» (Информант Адашкович Бронислава Никодимовна, 1948 г. р., д. Заберезь Ивьевского р-на Гродненской обл., родом из д. Борисовка, записал И. Бутов в 2019 году).

Литература

1. Гричик В. В., Прокопчук В. В., Гребенчук А. Е., Рябцева А. О., Цыбовский И. С. Шакал (Canis aureus L., 1758) – новый вид в териофауне Беларуси // Журнал Белорусского государственного университета. Биология. 2018. № 3. С. 55–61.

2. Алексинская О. А. Мозырская «чупакабра» – что говорит наука? / О. А. Алексинская, В. С. Алексинский, Д. А. Зиновкин, А. В. Шпак, Е. Э. Хейдорова, М. А. Дебелый // Лабораторная диагностика. Восточная Европа. 2019. Том. 8. № 4. С. 574–584.

3. Костанайские санэпидемиологи ищут специалиста, который бы провел вскрытие таинственного монстра // Костанайские новости (электронный ресурс). URL: https://kstnews.kz/news/incidents/item-27603. Дата доступа: 15.01.2016.

4. Утенова З. Неопознанное существо из костанайской глубинки исследуют биологи // Телеканал КТК (электронный ресурс). URL: https://www.ktk.kz/ru/news/video/2016/01/18/66190/. Дата доступа: 18.01.2016.

5. Биолог не смог определить вид загадочного существа из Костаная // Информ-бюро (электронный ресурс). URL: https://informburo.kz/novosti/podrobnosti-obnaruzheniya-zagadochnogo-sushchestva-v-kostanayskoy-oblasti.html. Дата доступа: 15.01.2016.

6. Маяковская А. Биологи приблизились к разгадке природы обнаруженного в Костанайской области неведомого существа // Новости Казахстана (электронный ресурс). URL: https://www.nur.kz/1015421-biologi-priblizilis-k-razgadke-prir.html. Дата доступа: 18.01.2016.

7. В Костанайской области обнаружено странное существо // Костанайские новости (электронный ресурс). URL: https://kstnews.kz/news/incidents/item-27570. Дата доступа: 14.01.2016.

8. Агимбетов Б. Обнаруженное в Костанайской области загадочное существо исследуют биологи // Информ-бюро (электронный ресурс). URL: https://informburo.kz/novosti/obnaruzhennoe-v-kostanayskoy-oblasti-zagadochnoe-sushchestvo-issleduyut-biologi.html. Дата доступа: 14.01.2016.

9. «Неизвестное существо» может оказаться желудком травоядного животного // Tengrinews: актуальные новости в любое время (электронный ресурс). URL: https://tengrinews.kz/kazakhstan_news/neizvestnoe-suschestvo-okazatsya-jeludkom-travoyadnogo-287736/. Дата доступа: 22.02.2016.

10. Бодрова Е. «Загадочное» существо из Костанайской области может оказаться кишкой животного (электронный ресурс). URL: https://informburo.kz/novosti/zagadochnoe-sushchestvo-iz-kostanayskoy-oblasti-mozhet-okazatsya-kishkoy-zhivotnogo.html. Дата доступа: 21.01.2016.

11. Мезенцев В. А. Человек ищет чудо / В. А. Мезенцев. М.: Дет. лит., 1978. C. 17–18.

12. Демин М. Рыжий дьявол. М.: «Центрполиграф», 1987. С. 110–111.

13. Andrews R. C. On the trail of ancient man: a narrative of the field work of the Central Asiatic Expeditions. New York – London: Knickerbocker Press, 1926. Pp. 103–104.

14. Эндрюз Р. Ч. По следам первобытного человека: экспедиция в Центральную Азию. Л.: Изд-во П. П. Сойкин, 1927. Кн. 2. С. 29–30.

15. Танасийчук В. Невероятная зоология. Зоологические мифы и мистификации. М.: Товарищество научных изданий КМК, 2011. С. 215.

16. Ефремов И. Дорога Ветров. Гобийские заметки. М.: Географгиз, 1962. С. 31–32.

17. Халтуева Г. О. Топонимический лексикон «Сокровенного сказания монголов» и «Кодзики»: общее и частное: дис. ... канд. филолог. наук. Улан-Удэ, 2009. С. 122.

18. Воронин П. Зверь хитрый и опасный // Экспресс-К. 2008. № 38 (электронный ресурс). URL: https://express-k.kz/news/sotsium/kto_vskroet_kostanayskogo_chuzhogo_-64603?sphrase_id=4371949. Дата доступа: 29.02.2008.

19. Рост, Ю. Путешествие по Монголии в поисках легенды // Новая газета. 29 марта 2012 (электронный ресурс). URL: https://novayagazeta.ru/articles/2012/03/29/49030-ah-gobi. Дата доступа: 01.10.19.

20. Созвездие славных имен (выдающиеся деятели культуры России): биографические очерки о литераторах XVIII–XX вв. / Гл. ред. и сост. С. П. Гладкий. СПб.: Горн. ин-т, 1995. С. 92–93.

21. Тайна олгой-хорхоя // Огонек. 1958. № 15. С. 27.

22. Мызникова Е. А. Научно-художественный синтез в рассказах И. А. Ефремова 1940-х гг.: дис. ... канд. филолог. наук. Барнаул, 2012. С. 41, 83.

23. Кузьмин С. Л. Земноводные Монголии / С. Л. Кузьмин, Е. А. Мунхбаяр, М. Мунхбаатар, Ж. Оюунчимэг, Х. Тэрбиш. Москва: КМК, 2017. С. 17.

24. Симуков А. Д. Труды о Моноголии и для Моноголии. Т. 1. Осака: Государственный музей этнологии, 2007. С. 280.

25. Симуков А. Д. Труды о Моноголии и для Моноголии. Т. 3. Ч. 2. Осака: Государственный музей этнологии, 2008. С. 244.

26. Липовский Ю. О. Самоцветное ожерелье Гоби / Отв. ред. Р. А. Хасин. Л.: Наука. Ленингр. отд-ние, 1991. С. 143–144.

27. Zhang D-X., Hewitt G. M. (1998) Isolation of Animal Cellular Total DNA / Karp A., Isaac P.G., Ingram D.S. (eds) // Molecular Tools for Screening Biodiversity. Springer, Dordrecht. Pp. 5–9.

28. Verma S. (2002). Novel universal primers establish identity of enormous number of animal species for forensic application // Molecular Ecology Notes. 3 (1). Pp. 28–31. DOI: 10.1046/j.1471-8286.2003.00340.x.

29. Xia X. et al. Abundant Genetic Diversity of Yunling Cattle Based on Mitochondrial Genome // Animals. 2019. 9 (9). P. 641.

30. Дандыбаев Ф. «Инопланетное существо» оказалось фрагментом кишечной системы крупнорогатого скота // Костанайские новости (электронный ресурс). URL: https://kstnews.kz/news/man-and-nature/item-28870. Дата доступа: 10.11.19.

31. Тезга А. А. Ветеринарно-биологическая экспертиза материала, поступившего из Ауликольского района Костанайской области // GISAP: Biology, veterinary medicine and agricultural sciences. 2016. № 11. С. 28–32.

32. Новиков Ю. А. Змея в мифологических сказаниях и верованиях старообрядцев Литвы // Славянские чтения. Т. I. Даугавпилс – Резекне: Изд-во Латгальского культурного центра, 2000. С. 7–12.

33. Адамкович А. Фольклор старообрядцев Шарковщины (cоциолингвистический аспект). Вильнюс, 2008. С. 202.

34. Веретеница // Природа Белоруссии: популярная энциклопедия. Минск: Белорусская Советская Энциклопедия, 1989. С. 377.

Опубликовано: Бутов, И. С. Молекулярно-генетический анализ образца ткани «баганалинского червя» / И. С. Бутов, Е. Н. Сысолятин, О. И. Бородин // Лабораторная диагностика. Восточная Европа. 2020. Т. 9. № 3. С. 272–284.

Смотрите также:Мозырская «чупакабра» – что говорит наука?


Илья Бутов, Евгений Сысолятин, Олег Бородин 11.10.2020
 
Если у вас есть дополнительная информация по этой публикации, пишите нам на ufocom@tut.by Подписывайтесь на наш телеграмм или вайбер каналы, чтобы всегда быть в курсе событий.
 
 
Таинственные лики Бельмеза
НЛО и АЯ 17
Таинственные лики Бельмеза
Не так давно на сайте проекта «Уфоком» появилась статья о возникновении странного изображения на одном из домов в Барановичах. В статье упоминались также и знаменитые лики Бельмеза. Что же это был за случай: одно из самых выдающихся паранормальных происшествий в истории или искусная мистификация?
"Tricolor": возвращение из бездны?
Курьезы 1
"Tricolor": возвращение из бездны?
В 1958 году высокопоставленный офицер НАТО Дж. Е. Робинсон рассказал о встрече с призраком норвежского теплохода "Tricolor", который взорвался и затонул неподалеку от побережья Цейлона (ныне Шри-Ланка). Попытались разобраться, имеются ли у его истории другие объяснения, кроме столкновения с чем-то сверхъестественным?